
VroniPlag Wiki

Rlm/Fragment 052 02

< Rlm

32.291Seiten in
diesem Wiki
Seite hinzufügen
Diskussion0 Teilen

Graf Isolan
Untersuchte Arbeit:
Seite: 52, Zeilen: 2-11, 13-14
Quelle: Rizzolio 2010
Seite(n): 61, 64-65, Zeilen: 61:9-12; 64:19-22 - 65:1-3

shRNA plasmids Pin1 (SHCLNG-NM_006221) were from Sigma Inc., St Louis, MO, USA. Scrambled shRNA (17920), psPAX2 packaging plasmid (12260), pMDG.2 envelop plasmid (12259) and PwPI (12254) were from Addgene Inc, Cambridge, MA, USA. For overexpression experiments, the IMAGE: 3941595 clone was utilized to amplify the Pin1 human gene with the oligonucleotide primers PIN1-BamHIF GCGGATCCGCGGCAGGAGGGAAGATGG at the 5’ end and PIN1-EcoRIR GCGAATTCCTGGGCTCCCCACCCTCAC at the 3’ with BamHI and EcoRI adaptor sequences, respectively. The plasmid was sequenze verified.

GST pull-down experiment: the PCR generated Pin1 (PIN1-BamHIF and PIN1-EcoRIR) were ligated in the pGEX-2T plasmid for the prokaryotic expression vector (Stratagene Inc., La Jolla CA, USA).

[Page 61]

shRNA plasmids for pRB (SHCLNG-NM_000321), PIN1 (SHCLNGNM_006221) were from Sigma Inc., St Louis, MO, USA. Scrambled shRNA (17920), psPAX2 packaging plasmid (12260), pMDG.2 envelope plasmid (12259) were from Addgene Inc, Cambridge, MA, USA.

[Page 64]

For GST pull-down experiment, the IMAGE: 3941595 clone was utilized to amplify the PIN1 human gene with the oligonucleotide primers PIN1-BamHIF GCGGATCCGCGGCAGGAGGGAAGATGG at the 5’ end and PIN1-EcoRIR GCGAATTCCTGGGCTCCCCACCCTCAC at the 3’ with BamHI and EcoRI

[Page 65]

adaptor sequences, respectively. The PCR generated products were ligated in the pGEX-2T plasmid for the prokaryotic expression vector (Stratagene Inc., La Jolla CA, USA).


Adapted, but still in many parts identical.

(Graf Isolan), SleepyHollow02

Störung durch Adblocker erkannt!

Wikia ist eine gebührenfreie Seite, die sich durch Werbung finanziert. Benutzer, die Adblocker einsetzen, haben eine modifizierte Ansicht der Seite.

Wikia ist nicht verfügbar, wenn du weitere Modifikationen in dem Adblocker-Programm gemacht hast. Wenn du sie entfernst, dann wird die Seite ohne Probleme geladen.

Auch bei Fandom

Zufälliges Wiki