3 gesichtete Fragmente: "Verdächtig" oder "Keine Wertung"

[1.] Rlm/Fragment 048 01 - Diskussion
Bearbeitet: 1. December 2014, 16:33 (SleepyHollow02)
Erstellt: 3. November 2014, 12:45 Hindemith
Bao et al 2004, Fragment, Gesichtet, KeineWertung, Rlm, SMWFragment, Schutzlevel

Untersuchte Arbeit:
Seite: 48, Zeilen: 1-3
Quelle: Bao et al 2004
Seite(n): 1727, Zeilen: 1227: r.col: 29 ff.  ; 1731: l.col: 6 ff.
Recently, it has been reported that Pin1 is overexpressed in human prostate cancer cell lines and prostate cancer tissues, and its expression closely correlates with the level of cyclin D1 in tumors. Recently, it has been reported that Pin1 is overexpressed in human breast cancer cell lines and breast cancer tissues, and its expression closely correlates with the level of cyclin D1 in tumors.15

15. Wulf GM, Ryo A, Wulf GG, Lee SW, Niu T, Lu KP: Pin1 is overexpressed in breast cancer and potentiates the transcriptional activity of phosphorylated c-Jun towards the cyclin D1 gene. EMBO J 2001, 20:3459–3472


The source is not mentioned.

By copying the passage from a seven year old source, the meaning of "recently" is somewhat stretched.

(Hindemith), SleepyHollow02

[2.] Rlm/Fragment 052 02 - Diskussion
Bearbeitet: 5. December 2014, 18:52 (SleepyHollow02)
Erstellt: 5. December 2014, 00:10 Graf Isolan
Fragment, Gesichtet, KeineWertung, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel

Graf Isolan
Untersuchte Arbeit:
Seite: 52, Zeilen: 2-11, 13-14
Quelle: Rizzolio 2010
Seite(n): 61, 64-65, Zeilen: 61:9-12; 64:19-22 - 65:1-3

shRNA plasmids Pin1 (SHCLNG-NM_006221) were from Sigma Inc., St Louis, MO, USA. Scrambled shRNA (17920), psPAX2 packaging plasmid (12260), pMDG.2 envelop plasmid (12259) and PwPI (12254) were from Addgene Inc, Cambridge, MA, USA. For overexpression experiments, the IMAGE: 3941595 clone was utilized to amplify the Pin1 human gene with the oligonucleotide primers PIN1-BamHIF GCGGATCCGCGGCAGGAGGGAAGATGG at the 5’ end and PIN1-EcoRIR GCGAATTCCTGGGCTCCCCACCCTCAC at the 3’ with BamHI and EcoRI adaptor sequences, respectively. The plasmid was sequenze verified.

GST pull-down experiment: the PCR generated Pin1 (PIN1-BamHIF and PIN1-EcoRIR) were ligated in the pGEX-2T plasmid for the prokaryotic expression vector (Stratagene Inc., La Jolla CA, USA).

[Page 61]

shRNA plasmids for pRB (SHCLNG-NM_000321), PIN1 (SHCLNGNM_006221) were from Sigma Inc., St Louis, MO, USA. Scrambled shRNA (17920), psPAX2 packaging plasmid (12260), pMDG.2 envelope plasmid (12259) were from Addgene Inc, Cambridge, MA, USA.

[Page 64]

For GST pull-down experiment, the IMAGE: 3941595 clone was utilized to amplify the PIN1 human gene with the oligonucleotide primers PIN1-BamHIF GCGGATCCGCGGCAGGAGGGAAGATGG at the 5’ end and PIN1-EcoRIR GCGAATTCCTGGGCTCCCCACCCTCAC at the 3’ with BamHI and EcoRI

[Page 65]

adaptor sequences, respectively. The PCR generated products were ligated in the pGEX-2T plasmid for the prokaryotic expression vector (Stratagene Inc., La Jolla CA, USA).


Adapted, but still in many parts identical.

(Graf Isolan), SleepyHollow02

[3.] Rlm/Fragment 042 03 - Diskussion
Bearbeitet: 6. December 2014, 18:57 (SleepyHollow02)
Erstellt: 5. December 2014, 11:02 Graf Isolan
Fragment, Gesichtet, Gordon et al 2010, KeineWertung, Rlm, SMWFragment, Schutzlevel

Graf Isolan
Untersuchte Arbeit:
Seite: 42, Zeilen: 3-6
Quelle: Gordon et al 2010
Seite(n): 2267, Zeilen: 17-19
The role of Ser81 has been widely studied, recently according to our data Gioeli et al. discovered that LHS cells stably expressing wild-type and S81A mutant AR showed differences in the regulation of endogenous AR target genes, suggesting that S81 phosphorylation regulates promoter selectivity. LHS cells stably expressing wild-type and S81A mutant AR showed differences in the regulation of endogenous AR target genes, suggesting that S81 phosphorylation regulates promoter selectivity.

Although from some point onward identical, nothing has been marked as a citation.

Gioeli is one of the co-authors of Gordon et al 2010.

(Graf Isolan), SleepyHollow02

Störung durch Adblocker erkannt!

Wikia ist eine gebührenfreie Seite, die sich durch Werbung finanziert. Benutzer, die Adblocker einsetzen, haben eine modifizierte Ansicht der Seite.

Wikia ist nicht verfügbar, wenn du weitere Modifikationen in dem Adblocker-Programm gemacht hast. Wenn du sie entfernst, dann wird die Seite ohne Probleme geladen.

Auch bei FANDOM

Zufälliges Wiki